WormBase Tree Display for Variation: WBVar00249754
expand all nodes | collapse all nodes | view schema
WBVar00249754 | Name | Public_name | tm724 | ||||||
---|---|---|---|---|---|---|---|---|---|
HGVSg | |||||||||
Sequence_details | SMap | S_parent | Sequence | C06A5 | |||||
Flanking_sequences | ttctgaattccgtccactatcactatcata | gctgcccaacttttcttctcgttcatcttc | |||||||
Mapping_target | C06A5 | ||||||||
Source_location | 7 | CHROMOSOME_I | 5996048 | 5996734 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | AAAAAAAAAAAAATNGG | |||||||
Deletion | |||||||||
PCR_product | tm724_external | ||||||||
tm724_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 724 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006823 | |||||||
Transcript | C06A5.7b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-543 | ||||||||
CDS_position | ?-396 | ||||||||
Protein_position | ?-132 | ||||||||
Intron_number | 4/11 | ||||||||
Exon_number | 5/12 | ||||||||
C06A5.7a.2 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-717 | ||||||||
CDS_position | ?-369 | ||||||||
Protein_position | ?-123 | ||||||||
Intron_number | 4/11 | ||||||||
Exon_number | 5/12 | ||||||||
C06A5.7a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-623 | ||||||||
CDS_position | ?-369 | ||||||||
Protein_position | ?-123 | ||||||||
Intron_number | 5/12 | ||||||||
Exon_number | 6/13 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | I | |||||||
Description | Phenotype | WBPhenotype:0000062 | Paper_evidence | WBPaper00032338 | |||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
A number of progeny arrested development during embryogenesis or early larval stages (38% lethal, n=40). | Paper_evidence | WBPaper00032338 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032338 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00032338 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000366 | Paper_evidence | WBPaper00032338 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrested embryos (45%, n=22) were paralyzed at about the 3.5-fold stage and failed to hatch, as determined by time-lapse Nomarski. | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032338 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00032338 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0001292 | Paper_evidence | WBPaper00032338 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Although actin organization was severely disorganized and formed a number of aggregates alpha-actinin and other myofibril components were only slightly affected. These other components, including myosin, were not found in the actin aggregates. | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032338 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00032338 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001569 | Paper_evidence | WBPaper00032338 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Striation of myosin thick filaments was less organized compared to control animals; myosin heavy chain was often wider with irregular spacing between bands. | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032338 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00032338 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001587 | Paper_evidence | WBPaper00032338 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Actin organization was severely disorganized and the striated pattern of actin filaments was difficult to discern. Actin arrays were discontinuous and a number of aggregates were formed in body wall muscles. These aggregates did not contain alpha-actinin. | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00032338 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032338 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00032338 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000002 | PATO:0000460 | Paper_evidence | WBPaper00032338 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00032338 | ||||||||
Remark | 15952/15953-AAAAAAAAAAAAATNGG-16637/16638 (685 bp deletion + 17 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |