WormBase Tree Display for Variation: WBVar00249765

WBVar00249765 Name: Public_name: tm736
    Other_name: Y48E1B.7.1:c.1046_1050-69del
    HGVSg: CHROMOSOME_II:g.13580228_13580859del
  Sequence_details: SMap: S_parent: Sequence: Y48E1B
    Flanking_sequences: ccgcgttctataataaagcctatttggata ttttttttgcgaaaaataccacatttttga
    Mapping_target: Y48E1B
    Source_location: 7 CHROMOSOME_II 13580227 13580860 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm736_external
      tm736_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 736
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00013006
    Transcript: Y48E1B.7.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y48E1B.7.1:c.1046_1050-69del
        cDNA_position: 1052-?
        CDS_position: 1046-?
        Protein_position: 349-?
        Intron_number: 6/10
        Exon_number: 6/11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000055 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. R.H. Horvitz to the National Bioresource Project of Japan: arrests at L1-L2 larvae. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: MT
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. R.Waterston to the National Bioresource Project of Japan: Dead eggs = 0/197. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: RW
  Remark: 55849/55850-56481/56482 (632 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele