WormBase Tree Display for Variation: WBVar00249767

WBVar00249767 Name: Public_name: tm738
    Other_name (24)
    HGVSg: CHROMOSOME_X:g.10807532_10808101del
  Sequence_details: SMap: S_parent: Sequence: F31B12
    Flanking_sequences: agctcctcctggctcactggacagcgacga cctgaaatatcataaattgaacatcgttat
    Mapping_target: F31B12
    Source_location: 7 CHROMOSOME_X 10807531 10808102 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm738_external
      tm738_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 738
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004036
    Transcript (12)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. H. Baylis: PLoS Genetics 4, e1000043 (2008). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. V. Maricq to the National Bioresource Project of Japan: mostly sterile Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
        Penetrance: High: Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
      WBPhenotype:0000979 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. V. Maricq to the National Bioresource Project of Japan: has a defect in spermatheca dilation Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000983 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. V. Maricq to the National Bioresource Project of Japan: defect in spermatheca dilation leads to failure in fertilization. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 11030/11031-11600/11601 (570 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele