WormBase Tree Display for Variation: WBVar00249772
expand all nodes | collapse all nodes | view schema
WBVar00249772 | Name | Public_name | tm743 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | B0395.1.2:c.1018+24_1327delinsG | |||||||
B0395.1.1:c.1018+24_1327delinsG | ||||||||
HGVSg | CHROMOSOME_X:g.16020626_16021053delinsG | |||||||
Sequence_details | SMap | S_parent | Sequence | B0395 | ||||
Flanking_sequences | ttcctcggtatgttatttaactatcaccat | tgtgcggtgttgaagcaataattggagctc | ||||||
Mapping_target | B0395 | |||||||
Source_location | 7 | CHROMOSOME_X | 16020625 | 16021054 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | G | ||||||
Deletion | ||||||||
PCR_product | tm743_external | |||||||
tm743_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 743 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003729 | ||||||
Transcript | B0395.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | B0395.1.1:c.1018+24_1327delinsG | |||||||
cDNA_position | ?-1633 | |||||||
CDS_position | ?-1327 | |||||||
Protein_position | ?-443 | |||||||
Intron_number | 11-13/15 | |||||||
Exon_number | 12-14/16 | |||||||
B0395.1.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0395.1.2:c.1018+24_1327delinsG | |||||||
cDNA_position | ?-1340 | |||||||
CDS_position | ?-1327 | |||||||
Protein_position | ?-443 | |||||||
Intron_number | 10-12/14 | |||||||
Exon_number | 11-13/15 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000324 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dr. N. Tavernarakis: slightly shorter. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Labouesse: no genetic interactions between other vha-5 alleles. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000531 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dr. N. Tavernarakis: normal development. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dr. N. Tavernarakis: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000673 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dr. N. Tavernarakis: normal brood size. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 1506/1507-G-1934/1935 (428 bp deletion + 1 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |