WormBase Tree Display for Variation: WBVar00249782

WBVar00249782 Name: Public_name: tm753
    Other_name (12)
    HGVSg: CHROMOSOME_X:g.10808446_10808933del
  Sequence_details: SMap: S_parent: Sequence: F31B12
    Flanking_sequences: ctcctctactccaactcctccagttcctgg ataacaacaggatgcatcagctgatatcat
    Mapping_target: F31B12
    Source_location: 7 CHROMOSOME_X 10808445 10808934 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm753_external
      tm753_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 753
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004036
    Transcript (12)
    Interactor: WBInteraction000517565
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000154 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. V. Maricq to the National Bioresource Project of Japan: reduced brood size likely result of faulty spermatheca dilation. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. H. Baylis: PLoS Genetics 4, e1000043 (2008). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000436 Paper_evidence: WBPaper00040857
        Curator_confirmed: WBPerson712
        Remark: Mutation did not cause SNB-1::VENUS localization defects. Paper_evidence: WBPaper00040857
            Curator_confirmed: WBPerson712
      WBPhenotype:0000743 Paper_evidence: WBPaper00046355
        Curator_confirmed: WBPerson51
        Remark: Figure 1G Paper_evidence: WBPaper00046355
            Curator_confirmed: WBPerson51
        EQ_annotations: GO_term: GO:0016246 PATO:0000460 Paper_evidence: WBPaper00046355
                Curator_confirmed: WBPerson51
  Reference: WBPaper00040857
    WBPaper00046355
  Remark: 11944/11955-12432/12433 (478 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele