WormBase Tree Display for Variation: WBVar00249787
expand all nodes | collapse all nodes | view schema
WBVar00249787 | Name | Public_name | tm758 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE43273:p.Asp655_Ter806delextTer? | |||||||
B0393.5.1:c.1963_2418del | ||||||||
HGVSg | CHROMOSOME_III:g.4771857_4772409del | |||||||
Sequence_details | SMap | S_parent | Sequence | B0393 | ||||
Flanking_sequences | catgaaacaattctatatccaatttcaaat | caagctcgaggtccaatgactggaatttca | ||||||
Mapping_target | B0393 | |||||||
Source_location | 7 | CHROMOSOME_III | 4771856 | 4772410 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm758_external | |||||||
tm758_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 758 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00007170 | ||||||
Transcript | B0393.5.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000032 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. K. Nishiwaki to the National Bioresource Project of Japan: healthy. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. K. Nishiwaki to the National Bioresource Project of Japan: fertile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 20264/20265-20817/20818 (553 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |