WormBase Tree Display for Variation: WBVar00249789
expand all nodes | collapse all nodes | view schema
WBVar00249789 | Name | Public_name | tm760 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C08A9.1.1:c.53+143_364-76del | |||||||
HGVSg | CHROMOSOME_X:g.17092963_17093677del | |||||||
Sequence_details | SMap | S_parent | Sequence | C08A9 | ||||
Flanking_sequences | ataattaatttttgcaagctccttttaaat | gatgtttctttattaacattttcgttaata | ||||||
Mapping_target | C08A9 | |||||||
Source_location | 7 | CHROMOSOME_X | 17092962 | 17093678 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm760_external | |||||||
tm760_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00007661 | |||||||
WBStrain00026684 | ||||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 760 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00015583 | ||||||
WBGene00004932 | ||||||||
Transcript | C08A9.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C08A9.1.1:c.53+143_364-76del | |||||||
Intron_number | 2-4/6 | |||||||
Exon_number | 3-4/7 | |||||||
C08A9.3a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2/16 | |||||||
Exon_number | 1-2/17 | |||||||
Interactor (18) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000039 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. S. Yanase: normal lifespan on 20C | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. S. Yanase: normal lifespan on 20C. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000308 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. G. Ruvkun to the National Bioresource Project of Japan: no effect on dauer arrest. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000520 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. WB Derry to the National Bioresource Project of Japan: WT morphology. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001739 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Driscoll: no significant effects on aging. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00065316 | |||||||
Remark | 14553/14554-15268/15269 (715 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |