WormBase Tree Display for Variation: WBVar00249798

WBVar00249798 Name: Public_name: tm769
    Other_name: ZK546.5.1:c.159+4_598delinsAAAGG
    HGVSg: CHROMOSOME_II:g.4936031_4936633delinsAAAGG
  Sequence_details: SMap: S_parent: Sequence: ZK546
    Flanking_sequences: acaatcaggagtattgactgtaaatgaggt taggagctcacgaggttcagaatctgacgt
    Mapping_target: ZK546
    Source_location: 7 CHROMOSOME_II 4936029 4936634 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AAAAGG
      Deletion
    PCR_product: tm769_external
      tm769_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 769
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022762
    Transcript: ZK546.5.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: ZK546.5.1:c.159+4_598delinsAAAGG
        cDNA_position: ?-598
        CDS_position: ?-598
        Protein_position: ?-200
        Intron_number: 2-4/8
        Exon_number: 3-5/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 19375/19376-AAAAGG-19979/19980 (604 bp deletion + 6 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele