WormBase Tree Display for Variation: WBVar00249804
expand all nodes | collapse all nodes | view schema
WBVar00249804 | Name | Public_name | tm776 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C15F1.7a.1:c.135_*115del | |||||||
HGVSg | CHROMOSOME_II:g.6972761_6973372del | |||||||
Sequence_details | SMap | S_parent | Sequence | C15F1 | ||||
Flanking_sequences | tgaaattttgaagaaattttatgtgaaaat | ttctgaaaaagaatacaaatgatttaagcg | ||||||
Mapping_target | C15F1 | |||||||
Source_location | 7 | CHROMOSOME_II | 6972760 | 6973373 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm776_external | |||||||
tm776_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00007569 | |||||||
WBStrain00007662 | ||||||||
WBStrain00047284 | ||||||||
WBStrain00047285 | ||||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 776 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00196089 | ||||||
WBGene00004930 | ||||||||
Transcript | C15F1.7b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | 69-? | |||||||
CDS_position | 69-? | |||||||
Protein_position | 23-? | |||||||
Intron_number | 2-3/3 | |||||||
Exon_number | 2-4/4 | |||||||
C15F1.13 | VEP_consequence | non_coding_transcript_exon_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 75-? | |||||||
Exon_number | 1/1 | |||||||
C15F1.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C15F1.7a.1:c.135_*115del | |||||||
cDNA_position | 142-665 | |||||||
CDS_position | 135-? | |||||||
Protein_position | 45-? | |||||||
Intron_number | 4-5/6 | |||||||
Exon_number | 4-7/7 | |||||||
Interactor | WBInteraction000503939 | |||||||
WBInteraction000504370 | ||||||||
WBInteraction000586828 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0000039 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. S. Yanase: slightly short life span on 20C | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000308 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. S. Yanase: dauer arrest abnormal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00032989 | ||||||
Curator_confirmed | WBPerson708 | |||||||
Remark | e.g. Figure 3. (A) and (B): sod-1 deletion strains's lifespans shortened than wild-type N2, however, transgenic strains's lifespans recovered to the wild-type level. | Paper_evidence | WBPaper00032989 | |||||
Curator_confirmed | WBPerson708 | |||||||
Rescued_by_transgene | WBTransgene00005543 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00032989 | ||||
Curator_confirmed | WBPerson708 | |||||||
WBPhenotype:0001418 | Paper_evidence | WBPaper00044578 | ||||||
Curator_confirmed | WBPerson12259 | |||||||
Remark | Figure 3A | Paper_evidence | WBPaper00044578 | |||||
Curator_confirmed | WBPerson12259 | |||||||
WBPhenotype:0002382 | Paper_evidence | WBPaper00048427 | ||||||
Curator_confirmed | WBPerson11689 | |||||||
Phenotype_assay | Genotype | dvIs19 [Pgst-4::GFP::NLS] | Paper_evidence | WBPaper00048427 | ||||
Curator_confirmed | WBPerson11689 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).Dr. O. Hobert: Nat. Neurosci. 11, 894 (2008). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000308 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. G. Ruvkun to the National Bioresource Center of Japan: no effect on dauer arrest. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001620 | Paper_evidence | WBPaper00066254 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Oxidative stress, as measured by an Intestine-specific fluorescent marker (rxRFP), is not elevated in the sod-1(tm776) mutant compared to controls. | Paper_evidence | WBPaper00066254 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001739 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Driscoll: no significant effects on aging. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032989 | |||||||
WBPaper00044578 | ||||||||
WBPaper00048427 | ||||||||
WBPaper00066254 | ||||||||
Remark | 17154/17155-17766/17767 (612 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |