WormBase Tree Display for Variation: WBVar00249822
expand all nodes | collapse all nodes | view schema
WBVar00249822 | Name | Public_name | tm794 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C16C10.7b.1:c.69-5_316-163del | |||||||
C16C10.7a.1:c.69-5_316-163del | ||||||||
HGVSg | CHROMOSOME_III:g.4165523_4166169del | |||||||
Sequence_details | SMap | S_parent | Sequence | C16C10 | ||||
Flanking_sequences | tgcaaaaagcaaacattttgtcagctttct | aaattacgattattaaattttggaaattct | ||||||
Mapping_target | C16C10 | |||||||
Source_location | 7 | CHROMOSOME_III | 4165522 | 4166170 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm794_external | |||||||
tm794_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00007570 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 794 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004381 | ||||||
Transcript | C16C10.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C16C10.7a.1:c.69-5_316-163del | |||||||
Intron_number | 2-3/5 | |||||||
Exon_number | 3/6 | |||||||
C16C10.7b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C16C10.7b.1:c.69-5_316-163del | |||||||
Intron_number | 2-3/6 | |||||||
Exon_number | 3/7 | |||||||
Interactor | WBInteraction000501984 | |||||||
WBInteraction000519125 | ||||||||
WBInteraction000519470 | ||||||||
WBInteraction000541898 | ||||||||
WBInteraction000541899 | ||||||||
WBInteraction000541900 | ||||||||
WBInteraction000541901 | ||||||||
WBInteraction000541902 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype | WBPhenotype:0000195 | Paper_evidence | WBPaper00040713 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals have low penetrance, but reproducible defects in the migration of the posterior DTC. | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00040713 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00040713 | |||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from: Dr. Z. Ronai: J. Cell Biol. 165, 857-867 (2004). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Animals are viable. | Paper_evidence | WBPaper00040713 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00040713 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00040713 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are fertile. | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00040713 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00040713 | |||||||
Remark | 22868/22869-23515/23516 (647 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |