WormBase Tree Display for Variation: WBVar00249837

WBVar00249837 Name: Public_name: tm810
    Other_name: C27A12.2.1:c.960-175_1233+23del
    HGVSg: CHROMOSOME_I:g.6043683_6044154del
  Sequence_details: SMap: S_parent: Sequence: C27A12
    Flanking_sequences: gaatttcaaacagaaacgatcatttttcaa aatttaataattctaaggatttaaaaatcc
    Mapping_target: C27A12
    Source_location: 7 CHROMOSOME_I 6043682 6044155 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm810_external
      tm810_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 810
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016154
    Transcript: C27A12.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C27A12.2.1:c.960-175_1233+23del
        Intron_number: 4-5/8
        Exon_number: 5/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000031 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: slow growth. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
      WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: embryonic lethal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment from Dr. M. Han to the National Bioresource Project of Japan: sterile Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
  Remark: 7162/7163-7634/7635 (472 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele