WormBase Tree Display for Variation: WBVar00249848
expand all nodes | collapse all nodes | view schema
WBVar00249848 | Name | Public_name | tm821 | ||||||
---|---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | C24H11 | |||||
Flanking_sequences | ttatccgattttcagagcctttcgaccaac | taaaaactacatttcaagctcattttcagc | |||||||
Mapping_target | C24H11 | ||||||||
Source_location | 7 | CHROMOSOME_III | 11776951 | 11777598 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | A | |||||||
Deletion | |||||||||
PCR_product (2) | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 821 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | III | |||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Classified as 'homozygous viable' by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: Normal locomotion. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: Hermaphrodites are fertile. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001401 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: WT mitochondria in muscle. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003675 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Remark (2) | |||||||||
Method | NBP_knockout_allele |