WormBase Tree Display for Variation: WBVar00249855

WBVar00249855 Name: Public_name: tm828
    Other_name: C50H2.2b.1:c.540+3_658del
      C50H2.2a.1:c.642+3_760del
    HGVSg: CHROMOSOME_V:g.9905812_9906508del
  Sequence_details: SMap: S_parent: Sequence: C50H2
    Flanking_sequences: gtttaaatctcaccaaagacttcttaaggt taaaagttgtcgagtttgttggaactggag
    Mapping_target: C50H2
    Source_location: 7 CHROMOSOME_V 9905811 9906509 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm828_external
      tm828_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 828
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001211
      WBGene00008244
    Transcript: C50H2.2b.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C50H2.2b.1:c.540+3_658del
        cDNA_position: ?-658
        CDS_position: ?-658
        Protein_position: ?-220
        Intron_number: 4/8
        Exon_number: 5/9
      C50H2.2a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C50H2.2a.1:c.642+3_760del
        cDNA_position: ?-769
        CDS_position: ?-760
        Protein_position: ?-254
        Intron_number: 6/10
        Exon_number: 7/11
      C50H2.10.1 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Intron_number: 2/3
        Exon_number: 1-4/4
    Interactor: WBInteraction000500514
      WBInteraction000500515
      WBInteraction000500516
      WBInteraction000500517
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. R.H. Horvitz to National Bioresource Project of Japan: normal Egl behavior; Does not modify Egl phenotype caused by unc-31, tph-1, egl-3 or egl-21. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. R.H. Horvitz to National Bioresource Project of Japan: normal locomotion behavior. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 20239/20240-20936/20937 (697 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele