WormBase Tree Display for Variation: WBVar00249856

WBVar00249856 Name: Public_name: tm829
    Other_name: CE50862:p.Lys71_Glu433delextTer?
      F59A6.1b.1:c.211_1299del
      F59A6.1a.1:c.253_1341del
      CE44901:p.Lys85_Glu447delextTer?
    HGVSg: CHROMOSOME_II:g.5023892_5025742del
  Sequence_details: SMap: S_parent: Sequence: F33G12
    Flanking_sequences: aagaatttacgcgttcgagaaatggctctg tattgggatgtggcaacttatttcgaagtt
    Mapping_target: F33G12
    Source_location: 7 CHROMOSOME_II 5023891 5025743 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm829_external
      tm829_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 829
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003822
    Transcript: F59A6.1a.1 (11)
      F59A6.1b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 28851/28852-30702/30703 (1851 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target F59A6 updated based on the VEP analysis pipeline to F33G12.
  Method: NBP_knockout_allele