WormBase Tree Display for Variation: WBVar00249874

WBVar00249874 Name: Public_name: tm848
    Other_name: CE34633:p.Glu46_Ter228delinsHis
      B0280.4.1:c.136_684delinsCAT
    HGVSg: CHROMOSOME_III:g.7108457_7109265delinsCAT
  Sequence_details: SMap: S_parent: Sequence: B0280
    Flanking_sequences: attcagaatcttcttcaaagtcagtcgaaa ttattgattgatgctgagccattgatcgat
    Mapping_target: B0280
    Source_location: 7 CHROMOSOME_III 7108456 7109266 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CAT
      Deletion
    PCR_product: tm848_external
      tm848_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 848
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003845
    Transcript: B0280.4.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000673 Paper_evidence: WBPaper00061827
        Curator_confirmed: WBPerson712
        Remark: A deletion mutant (tm848) that removes most of the odd-1 gene, including all three zinc fingers, has no significant effect on brood size when compared to wild-type worms. No significant difference was found in brood size (P=0.65), with an average wild-type brood size of 307 +/- 38 and an average mutant brood size of 301 +/- 33 (Figure 1B). Paper_evidence: WBPaper00061827
            Curator_confirmed: WBPerson712
  Reference: WBPaper00061827
  Remark: 6422/6423-CAT-7231/7232 (809 bp deletion + 3 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele