WormBase Tree Display for Variation: WBVar00249877
expand all nodes | collapse all nodes | view schema
| WBVar00249877 | Name | Public_name | tm851 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | CE53895:p.Ser322Ter | |||||||
| CE53987:p.Ser322Ter | ||||||||
| C47D12.1c.1:c.965_1753delinsGAAGTATATAATGCAT | ||||||||
| C47D12.1b.1:c.965_1753delinsGAAGTATATAATGCAT | ||||||||
| CE53926:p.Ser322Ter | ||||||||
| C47D12.1a.1:c.965_1753delinsGAAGTATATAATGCAT | ||||||||
| HGVSg | CHROMOSOME_II:g.11673914_11674791delinsATGCATTATATACTTC | |||||||
| Sequence_details | SMap | S_parent | Sequence | C47D12 | ||||
| Flanking_sequences | tacacgtatgcattatatacttcacaagat | acactagaagcggtccattttgcatgataa | ||||||
| Mapping_target | C47D12 | |||||||
| Source_location | 7 | CHROMOSOME_II | 11673913 | 11674792 | Inferred_automatically | National_Bioresource_Project | ||
| Type_of_mutation | Insertion | ATGCATTATATACTTC | ||||||
| Deletion | ||||||||
| PCR_product | tm851_external | |||||||
| tm851_internal | ||||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Laboratory | FX | |||||||
| Author | Mitani S | |||||||
| DB_info | Database | National_Bioresource_Project | seq | 851 | ||||
| NBP_allele | ||||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00007028 | ||||||
| Transcript | C47D12.1c.1 (11) | |||||||
| C47D12.1a.1 (11) | ||||||||
| C47D12.1b.1 (11) | ||||||||
| Isolation | Mutagen | TMP/UV | ||||||
| Genetics | Map | II | ||||||
| Mapping_data | In_multi_point | 4843 | ||||||
| Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. W.G. Kelly: could not recover. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. W.G. Kelly: could not recover. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | 18996/18997-ATGCATTATATACTTC-19874/19875 (878 bp deletion + 16 bp insertion) | |||||||
| This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
| Method | NBP_knockout_allele |
