WormBase Tree Display for Variation: WBVar00249878

WBVar00249878 Name: Public_name: tm852
    Other_name: CE07832:p.Tyr316LeufsTer8
      C02C6.1a.1:c.947_1542delinsTGGA
      C02C6.1b.1:c.947_1542delinsTGGA
      CE07833:p.Tyr316LeufsTer8
    HGVSg: CHROMOSOME_X:g.15570113_15570800delinsTGGA
  Sequence_details: SMap: S_parent: Sequence: C02C6
    Flanking_sequences: tgtttgctatggaaaaggatgtggccgagt aatcttggaaaccaggtgatcagaaagggc
    Mapping_target: C02C6
    Source_location: 7 CHROMOSOME_X 15570112 15570801 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TGGA
      Deletion
    PCR_product: tm852_external
      tm852_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 852
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001130
    Transcript: C02C6.1b.1 (11)
      C02C6.1a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000081 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. Z. Zhou to the National Bioresource Project of Japan: arrests at L1 stage. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000024 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
      WBPhenotype:0000117 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Hengartner to the National Bioresource Project of Japan: early L1 lethal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000241 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. Z. Zhou to the National Bioresource Project of Japan: does not bear any persistent cell corpses at 4-fold embryonic stage or arrested L1 stage. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000625 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. K. Shen to the National Bioresource Project of Japan: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000885 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Hengartner to the National Bioresource Project of Japan: no engulfment defects Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 35638/35639-TGGA-36326/36327 (688 bp deletion + 4 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele