WormBase Tree Display for Variation: WBVar00249880

WBVar00249880 Name: Public_name: tm854
    Other_name: C54F6.13a.2:c.905_1565delinsA
      C54F6.13a.1:c.905_1565delinsA
      CE32044:p.Leu302_Ter522delinsHis
      CE08985:p.Leu283_Ter503delinsHis
      C54F6.13b.1:c.848_1508delinsA
    HGVSg: CHROMOSOME_V:g.7541662_7542392delinsT
  Sequence_details: SMap: S_parent: Sequence: C54F6
    Flanking_sequences: ttagtaagcttgatcgcgtcctccagcgta gcattccgcaaacagcaatactgaaaatat
    Mapping_target: C54F6
    Source_location: 7 CHROMOSOME_V 7541661 7542393 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: T
      Deletion
    PCR_product: tm854_external
      tm854_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 854
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003731
    Transcript: C54F6.13a.1 (11)
      C54F6.13b.1 (11)
      C54F6.13a.2 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000324 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: slightly shorter. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0001395 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. M. Labouesse: displays a vacuole at the tip of nose. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
      WBPhenotype:0000531 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal development. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000673 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal brood size. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000948 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. M. Labouesse: normal cuticle Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
  Remark: 35022/35023-T-35753/35754 (731 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele