WormBase Tree Display for Variation: WBVar00249883

WBVar00249883 Name: Public_name: tm858
    Other_name: C06G4.2a.2:c.621_984delinsTTTTTTTTTTT
      C06G4.2b.2:c.483_846delinsTTTTTTTTTTT
      C06G4.2d.1:c.558_921delinsTTTTTTTTTTT
      C06G4.2c.1:c.*463_*826delinsTTTTTTTTTTT
      CE37744:p.Asn162PhefsTer37
      CE30486:p.Asn187PhefsTer37
      C06G4.2a.1:c.621_984delinsTTTTTTTTTTT
      CE37743:p.Asn208PhefsTer37
      C06G4.2b.1:c.483_846delinsTTTTTTTTTTT
    HGVSg: CHROMOSOME_III:g.7983034_7983439delinsTTTTTTTTTTT
  Sequence_details: SMap: S_parent: Sequence: C06G4
    Flanking_sequences: gaacccgaataatctcaacggtggaatggt ttattcttctcgaaacgtccaccaaaacgt
    Mapping_target: C06G4
    Source_location: 7 CHROMOSOME_III 7983033 7983440 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TTTTTTTTTTT
      Deletion
    PCR_product: tm858_external
      tm858_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 858
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000542
    Transcript: C06G4.2d.1 (11)
      C06G4.2a.2 (11)
      C06G4.2c.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C06G4.2c.1:c.*463_*826delinsTTTTTTTTTTT
        cDNA_position: 894-1257
        Intron_number: 6/14
        Exon_number: 6-7/15
      C06G4.2b.2 (11)
      C06G4.2a.1 (11)
      C06G4.2b.1 (11)
    Interactor: WBInteraction000052050
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000072 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal body size/shape. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000531 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Driscoll to the National Bioresource Project of Japan: normal development; Dr. N. Tavernarakis: normal development. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. M. Driscoll: normal locomotion; Dr. N. Tavernarakis: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000673 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. M. Driscoll: normal brood size; Dr. N. Tavernarakis: normal brood size. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 6097/6098-TTTTTTTTTTT-6503/6504 (406 bp deletion + 11 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele