WormBase Tree Display for Variation: WBVar00249889
expand all nodes | collapse all nodes | view schema
WBVar00249889 | Name | Public_name | tm864 | ||||||
---|---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | ZC482 | |||||
Flanking_sequences | cgtttaagcctaagtttaagcctaactcta | tcatatttcccaaaaatttcagccaaatca | |||||||
Mapping_target | ZC482 | ||||||||
Source_location | 7 | CHROMOSOME_III | 12784528 | 12785132 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm864_external | ||||||||
tm864_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 864 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Interactor | WBInteraction000501328 | |||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | III | |||||||
Description | Phenotype | WBPhenotype:0000646 | Paper_evidence | WBPaper00040420 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | These mutants have slight locomotion defects; they are lethargic and sluggish in the presence of food. | Paper_evidence | WBPaper00040420 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000661 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: solitary social feeding. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000850 | Paper_evidence | WBPaper00040420 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The anterior of young lgc-37 larvae (but not adults) is weakly touch insensitive. This phenotype is strongly enhanced in mec-4ts mutants at permissive temperatures. | Paper_evidence | WBPaper00040420 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00040420 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004028 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. C. Bargmann: reduced locomotion on food. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | CX | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000315 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. M. Chalfie: normal touch sensitivity. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | TU | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: normal egg-laying. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: normal locomotion. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: fertile. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040420 | ||||||||
Remark | 34040/34041-34643/34644 (603 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |