WormBase Tree Display for Variation: WBVar00249891
expand all nodes | collapse all nodes | view schema
WBVar00249891 | Name | Public_name | tm866 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C42D8.4a.4:c.313-488_*5+395del | ||||||||
HGVSg | CHROMOSOME_X:g.5079379_5080680del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C42D8 | |||||
Flanking_sequences | aatttttttcaaaaccaagccaataaacac | tactcttaaccataactacgtgttacattc | |||||||
Mapping_target | C42D8 | ||||||||
Source_location | 7 | CHROMOSOME_X | 5079378 | 5080681 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm866_external | ||||||||
tm866_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00029509 | ||||||||
Laboratory | FX | ||||||||
OH | |||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 866 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00016600 | |||||||
Transcript | C42D8.4a.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
Intron_number | 5-7/8 | ||||||||
Exon_number | 6-9/9 | ||||||||
C42D8.4b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 4-6/6 | ||||||||
Exon_number | 5-7/7 | ||||||||
C42D8.4a.4 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C42D8.4a.4:c.313-488_*5+395del | ||||||||
Intron_number | 2-6/6 | ||||||||
Exon_number | 3-6/7 | ||||||||
C42D8.4a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 4-6/7 | ||||||||
Exon_number | 5-8/8 | ||||||||
C42D8.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 5-7/8 | ||||||||
Exon_number | 6-9/9 | ||||||||
Interactor | WBInteraction000505128 | ||||||||
WBInteraction000505129 | |||||||||
WBInteraction000505130 | |||||||||
WBInteraction000505131 | |||||||||
WBInteraction000505132 | |||||||||
WBInteraction000505133 | |||||||||
WBInteraction000505134 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | X | |||||||
Description | Phenotype | WBPhenotype:0000962 | Paper_evidence | WBPaper00040214 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The intensity of expression of all of the BAG genes was reduced. | ets-5 mutants show reduced levels of ets-5::mCherry expression at multiple developmental stages. | Paper_evidence | WBPaper00040214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006825 | PATO:0000460 | Paper_evidence | WBPaper00040214 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00050780 | |||||||
Curator_confirmed | WBPerson14503 | ||||||||
WBPhenotype:0001510 | Paper_evidence | WBPaper00040214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The genes that are known to function specifically or nearly specifically in BAG neurons, such as flp-17, gcy-9, gcy-31, and gcy-33, showed greatly reduced expression across developmental stages in ets-5 mutants. | Paper_evidence | WBPaper00040214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006825 | PATO:0000460 | Paper_evidence | WBPaper00040214 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00050780 | |||||||
Curator_confirmed | WBPerson14503 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00040214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ets-5 mutants were defective in their ability to respond to all tested concentrations of CO2, and this CO2 response defect was present at all developmental stages. | Paper_evidence | WBPaper00040214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00040214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutants have normal life spans | Paper_evidence | WBPaper00040214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as 'homozygous viable' by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000306 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. O. Hobert: no effect on dat-1::gfp expression. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | OH | ||||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00040214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutants have normal brood sizes | Paper_evidence | WBPaper00040214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00032994 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants showed wildtype dat-1::gfp expression | Paper_evidence | WBPaper00032994 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | vtIs1 (dat-1::gfp;rol6) | Paper_evidence | WBPaper00032994 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00040214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | BAG neurons appear morphologically normal in ets-5 mutants, with an anterior process extending toward the tip of the nose and a posterior process that enters the nerve ring. | Paper_evidence | WBPaper00040214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006825 | PATO:0000460 | Paper_evidence | WBPaper00040214 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040214 | ||||||||
WBPaper00032994 | |||||||||
WBPaper00050780 | |||||||||
WBPaper00066004 | |||||||||
Remark | 429/430-1731/1732 (1302 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |