WormBase Tree Display for Variation: WBVar00249898
expand all nodes | collapse all nodes | view schema
WBVar00249898 | Name | Public_name | tm874 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.9658016_9658638del | |||||||
Sequence_details | SMap | S_parent | Sequence | C03D6 | ||||
Flanking_sequences | agttttgccttttaaagccgagaaaataaa | tcaatatgggatggtttgtggcaaatgagt | ||||||
Mapping_target | C03D6 | |||||||
Source_location | 7 | CHROMOSOME_I | 9658015 | 9658639 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm874_external | |||||||
tm874_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 874 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00007278 | ||||||
WBGene00007277 | ||||||||
Transcript | C03D6.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-322 | |||||||
CDS_position | ?-322 | |||||||
Protein_position | ?-108 | |||||||
Intron_number | 1/5 | |||||||
Exon_number | 1-2/6 | |||||||
C03D6.6.1 | VEP_consequence | 5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-8 | |||||||
Exon_number | 1/6 | |||||||
Interactor | WBInteraction000050626 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000050 | Paper_evidence | WBPaper00032269 | ||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson557 | |||||||
WBPerson712 | ||||||||
Remark | Comment from Dr. M. Colaiacovo to the National Bioresource Project of Japan: no embryonic lethality at 20 or 25 C. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Comment from Dr. M. Colaiacovo to the National Bioresource Project of Japan: fertile hermaphrodite. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000775 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Comment from Dr. M. Colaiacovo to the National Bioresource Project of Japan: No meiotic prophase defects observed on DAPI-stained gonads. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000886 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00032269 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson557 | |||||||
WBPerson712 | ||||||||
Remark | Comment from Dr. M. Colaiacovo to the National Bioresource Project of Japan: no apparent Him at 20 or 25 C. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00032269 | |||||||
Remark | 1189/1190-1812/1813 (623 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |