WormBase Tree Display for Variation: WBVar00249918

WBVar00249918 Name: Public_name: tm896
    HGVSg: CHROMOSOME_III:g.910393_911045del
  Sequence_details: SMap: S_parent: Sequence: F23H11
    Flanking_sequences: aggtgttgaactttccctggagctcgccgt ttgtttctttctctgttgcgcgtacggtag
    Mapping_target: F23H11
    Source_location: 7 CHROMOSOME_III 910392 911046 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm896_external
      tm896_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 896
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000263
    Transcript: F23H11.5.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-154
        CDS_position: ?-145
        Protein_position: ?-49
        Intron_number: 2/4
        Exon_number: 1-3/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0001535 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Comments to the National Bioresource Project of Japan: Dr. H.C. Korswagen: postdeirid defective. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
            Laboratory_evidence: FX
  Remark: 14636/14637-15289/15290 (653 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele