WormBase Tree Display for Variation: WBVar00249931

WBVar00249931 Name: Public_name: tm909
    Other_name: C17E7.5.1:c.607-12_735-255delinsTATAG
    HGVSg: CHROMOSOME_V:g.3867312_3867768delinsCTATA
  Sequence_details: SMap: S_parent: Sequence: C17E7
    Flanking_sequences: agcacttcaaaaatttgcaacacttttttt aaaaaaatctataaaaaaaggttttagcac
    Mapping_target: C17E7
    Source_location: 7 CHROMOSOME_V 3867311 3867769 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CTATA
      Deletion
    PCR_product: tm909_external
      tm909_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 909
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015900
    Transcript: C17E7.5.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C17E7.5.1:c.607-12_735-255delinsTATAG
        Intron_number: 2-3/4
        Exon_number: 3/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000661 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: social feeding. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
      WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: normal egg-laying. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
  Remark: 3479/3480-CTATA-3936/3937 (457 bp deletion + 5 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele