WormBase Tree Display for Variation: WBVar00249957

WBVar00249957 Name: Public_name: tm935
    Other_name: F29G9.3.1:c.182+14_246delinsTCAT
    HGVSg: CHROMOSOME_V:g.6018218_6018522delinsTCAT
  Sequence_details: SMap: S_parent: Sequence: F29G9
    Flanking_sequences: aaagttgtctacaaacggttcgtattttat gtcattcatcgttacgtagaactcctcgac
    Mapping_target: F29G9
    Source_location: 7 CHROMOSOME_V 6018217 6018523 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TCAT
      Deletion
    PCR_product: tm935_external
      tm935_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 935
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000159
    Transcript: F29G9.3.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F29G9.3.1:c.182+14_246delinsTCAT
        cDNA_position: ?-251
        CDS_position: ?-246
        Protein_position: ?-82
        Intron_number: 3/4
        Exon_number: 4/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comments to the NBP from Dr. S. L'Hernault: could not recover; Dr. O. Blacque: could not assess Dyf; Dr. G. Michaux: L1 Lvl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FL
              FX
              OEB
              SL
      WBPhenotype:0000117 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. G. Michaux: L1 Lvl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FL
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000103 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. G. Hermann to the National Bioresource Project of Japan: WT gut granules. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: GH
      WBPhenotype:0000706 Paper_evidence: WBPaper00025094
        Curator_confirmed: WBPerson2021
        Remark: No obvious gut granule defects Paper_evidence: WBPaper00025094
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: Staining with LysoTracker Red and acridine orange Paper_evidence: WBPaper00025094
              Curator_confirmed: WBPerson2021
  Reference: WBPaper00025094
  Remark: 17718/17719-TCAT-18023/18024 (305 bp deletion + 4 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele