WormBase Tree Display for Variation: WBVar00249960

WBVar00249960 Name: Public_name: tm938
    Other_name: Y39H10A.7a.1:c.699-74_932del
      Y39H10A.7b.1:c.423-74_656del
    HGVSg: CHROMOSOME_V:g.3758270_3758577del
  Sequence_details: SMap: S_parent: Sequence: Y39H10A
    Flanking_sequences: gatatggccgaagccatctattaaactcac gtttttattgttttttctcgtttatacaca
    Mapping_target: Y39H10A
    Source_location: 7 CHROMOSOME_V 3758269 3758578 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product (2)
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 938
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000498
    Transcript: Y39H10A.7a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y39H10A.7a.1:c.699-74_932del
        cDNA_position: ?-938
        CDS_position: ?-932
        Protein_position: ?-311
        Intron_number: 3/6
        Exon_number: 4/7
      Y39H10A.7b.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y39H10A.7b.1:c.423-74_656del
        cDNA_position: ?-656
        CDS_position: ?-656
        Protein_position: ?-219
        Intron_number: 2/4
        Exon_number: 3/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Hengartner: Cell Death Differ 14; 1129 (2007). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000116 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: 1) Dr. H. Sawa: homozygous lethal at L2-L3 stage and Unc. 2) Dr. H-S. Koo: as above. 3) Dr. S. Boulton: lethal at L2-L3. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000027 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
            WBls:0000035 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: 1) Dr. H. Sawa: Unc. 2) Dr. H-S. Koo: as above. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark (2)
  Method: NBP_knockout_allele