WormBase Tree Display for Variation: WBVar00249972

WBVar00249972 Name: Public_name: tm950
    Other_name: F35H8.6.1:c.122_283-11del
    HGVSg: CHROMOSOME_II:g.9586155_9586657del
  Sequence_details: SMap: S_parent: Sequence: F35H8
    Flanking_sequences: gtatattgtggattccaaagctgaaattca ctctcttgcaagaactgacattgtctgggc
    Mapping_target: F35H8
    Source_location: 7 CHROMOSOME_II 9586153 9586658 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: A
      Deletion
    PCR_product: tm950_external
      tm950_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 950
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009450
    Transcript: F35H8.6.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F35H8.6.1:c.122_283-11del
        cDNA_position: 128-?
        CDS_position: 121-?
        Protein_position: 41-?
        Intron_number: 2-3/9
        Exon_number: 2-3/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
    Mapping_data: In_multi_point: 5294
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000132 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from Dr. Y-K. Paik to the National Bioresource Project of Japan: dauer formed on daumone plate. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
  Remark: 35900/35901-A-36404/36405 (504 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele