WormBase Tree Display for Variation: WBVar00249974

WBVar00249974 Name: Public_name: tm952
    Other_name: W02B12.2.1:c.-2_310delinsGCACGG
    HGVSg: CHROMOSOME_II:g.11452584_11452947delinsCCGTGC
  Sequence_details: SMap: S_parent: Sequence: W02B12
    Flanking_sequences: aacggaatctagtcgagcacggacgactgt ttagaggtctgaaataagtgaagaatgaga
    Mapping_target: W02B12
    Source_location: 7 CHROMOSOME_II 11452583 11452948 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CCGTGC
      Deletion
    PCR_product: tm952_external
      tm952_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 952
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004699
    Transcript: W02B12.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: W02B12.2.1:c.-2_310delinsGCACGG
        cDNA_position: 9-320
        CDS_position: ?-310
        Protein_position: ?-104
        Intron_number: 2/6
        Exon_number: 1-3/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000673 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: wild-type brood size. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000676 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: wild-type growth rate. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000695 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: wild-type vulva. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 7672/7673-CCGTGC-8036/8037 (364 bp deletion + 6 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele