WormBase Tree Display for Variation: WBVar00249975

WBVar00249975 Name: Public_name: tm953
    Other_name: C18E9.7.1:c.382+27_1240del
    HGVSg: CHROMOSOME_II:g.8980795_8981819del
  Sequence_details: SMap: S_parent: Sequence: C18E9
    Flanking_sequences: ccaattgctttggtttcgatagatgcgcaa aataattgttggtggcatgttctcacccat
    Mapping_target: C18E9
    Source_location: 7 CHROMOSOME_II 8980794 8981820 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm953_external
      tm953_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 953
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007687
    Transcript: C18E9.7.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C18E9.7.1:c.382+27_1240del
        cDNA_position: ?-1266
        CDS_position: ?-1240
        Protein_position: ?-414
        Intron_number: 4-7/13
        Exon_number: 5-8/14
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 20510/20511-21535/21536 (1025 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele