WormBase Tree Display for Variation: WBVar00249986
expand all nodes | collapse all nodes | view schema
WBVar00249986 | Name | Public_name | tm964 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_III:g.9392303_9393466del | |||||||
Sequence_details | SMap | S_parent | Sequence | C38C10 | ||||
Flanking_sequences | cgtagaagagagcacttctgtaaaaataga | ccgctttctgatatgtcgtcaaatgtgttg | ||||||
Mapping_target | C38C10 | |||||||
Source_location | 7 | CHROMOSOME_III | 9392302 | 9393467 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm964_external | |||||||
tm964_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 964 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001689 | ||||||
Transcript | C38C10.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2-3/5 | |||||||
Exon_number | 1-3/6 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000697 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. J. Ahringer to the National Bioresource Project of Japan: non-Pvl. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001225 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Sawa to the National Bioresource Project of Japan: not Psa | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 22516/22517-23680/23681 (1164 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |