WormBase Tree Display for Variation: WBVar00249987

WBVar00249987 Name: Public_name: tm965
    HGVSg: CHROMOSOME_III:g.10333498_10334047del
  Sequence_details: SMap: S_parent: Sequence: T07C4
    Flanking_sequences: ccaaggctaccaggatccagaagctccgat ttcaaagaaaatcacagaaaatgcaacaaa
    Mapping_target: T07C4
    Source_location: 7 CHROMOSOME_III 10333497 10334048 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm965_external
      tm965_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 965
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00011563
    Transcript: T07C4.11a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-423
        CDS_position: ?-423
        Protein_position: ?-141
        Intron_number: 1-2/5
        Exon_number: 1-3/6
    Interactor: WBInteraction000521425
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype_not_observed: WBPhenotype:0000030 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. M. Han: wild-type growth. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000039 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. Yanase to the National Bioresource Project of Japan: normal lifespan on 20C. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. M. Han: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000699 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. M. Han: normal vulval development. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0002168 Paper_evidence: WBPaper00045092
        Curator_confirmed: WBPerson712
  Reference: WBPaper00045092
  Remark: 9363/9364-9913/9914 (550 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele