WormBase Tree Display for Variation: WBVar00249988

WBVar00249988 Name: Public_name: tm966
    Other_name: C44B12.2a.1:c.137-240_397del
    HGVSg: CHROMOSOME_IV:g.1108573_1109341del
  Sequence_details: SMap: S_parent: Sequence: C44B12
    Flanking_sequences: ataaatacctccgcaaccattagagctatc gagaatgcaagaagcttgatgagtgcaccg
    Mapping_target: C44B12
    Source_location: 7 CHROMOSOME_IV 1108572 1109342 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm966_external
      tm966_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 966
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003893
    Transcript: C44B12.2b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-136
        CDS_position: ?-136
        Protein_position: ?-46
        Intron_number: 1/3
        Exon_number: 1-2/4
      C44B12.2a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C44B12.2a.1:c.137-240_397del
        cDNA_position: ?-450
        CDS_position: ?-397
        Protein_position: ?-133
        Intron_number: 3-4/7
        Exon_number: 4-5/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. D. Sherwood: not a simple deletion but complex? Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
              NK
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 8156/8157-8925/8926 (769 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele