WormBase Tree Display for Variation: WBVar00249992

WBVar00249992 Name: Public_name: tm970
    HGVSg: CHROMOSOME_II:g.7183300_7184088delinsATA
  Sequence_details: SMap: S_parent: Sequence: C27H5
    Flanking_sequences: tttcagaattacaaataagttcaaataata gaacgcgagagcgtctccccccaatgcgcg
    Mapping_target: C27H5
    Source_location: 7 CHROMOSOME_II 7183299 7184089 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: ATA
      Deletion
    PCR_product: tm970_external
      tm970_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 970
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00044938
      WBGene00003966
    Transcript: C27H5.1.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2/5
        Exon_number: 1-2/6
      C27H5.9 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. D.M. Miller to the National Bioresource Project of Japan: no locomotory perturbations. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 31909/31910-ATA-32698/32699 (789 bp deletion + 3 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele