WormBase Tree Display for Variation: WBVar00250003
expand all nodes | collapse all nodes | view schema
WBVar00250003 | Name (3) | |||||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | C24G7 | ||||
Flanking_sequences | tgcaatttaaatccaattcggaaaacttat | cgcaagatttatattcatttacaatagata | ||||||
Mapping_target | C24G7 | |||||||
Source_location | 7 | CHROMOSOME_I | 4105029 | 4105595 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm981_external | |||||||
tm981_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 981 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00016064 | ||||||
Transcript | C24G7.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C24G7.2.1:c.490_729-225del | |||||||
cDNA_position | 505-? | |||||||
CDS_position | 490-? | |||||||
Protein_position | 164-? | |||||||
Intron_number | 6-7/15 | |||||||
Exon_number | 6-7/16 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000072 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal body size/shape. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000525 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. Y. Jin to the National Bioresource Project of Japan: normal behavior. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000531 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal development. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. N. Tavernarakis: normal locomotion; Dr. S. McIntire: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000673 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal brood size. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 39330/39331-39895/39896 (565 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |