WormBase Tree Display for Variation: WBVar00250026

WBVar00250026 Name: Public_name: tm1006
    HGVSg: CHROMOSOME_V:g.16002072_16003461del
  Sequence_details: SMap: S_parent: Sequence: C06C6
    Flanking_sequences: tcttgctttttcattgcacttttgatattt ttgtttcaacatggggagaagttcaggaca
    Mapping_target: C06C6
    Source_location: 7 CHROMOSOME_V 16002071 16003462 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1006_external
      tm1006_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1006
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003653
    Transcript: C06C6.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-380
        CDS_position: ?-373
        Protein_position: ?-125
        Intron_number: 2-4/7
        Exon_number: 1-5/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 13404/13405-14794/14795 (1390 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele