WormBase Tree Display for Variation: WBVar00250031
expand all nodes | collapse all nodes | view schema
WBVar00250031 | Name | Public_name | tm1011 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE19488:p.Asp135LeufsTer60 | |||||||
CE28733:p.Asp117LeufsTer60 | ||||||||
H10E21.3b.1:c.399_715del | ||||||||
H10E21.3a.1:c.345_661del | ||||||||
HGVSg | CHROMOSOME_III:g.13472_13917del | |||||||
Sequence_details | SMap | S_parent | Sequence | H10E21 | ||||
Flanking_sequences | ttttttttattagaaaactcacacaatgct | gtctgcggggacacattcgcgaatttctta | ||||||
Mapping_target | H10E21 | |||||||
Source_location | 7 | CHROMOSOME_III | 13471 | 13918 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1011_external | |||||||
tm1011_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004023 | |||||||
WBStrain00034506 | ||||||||
WBStrain00034508 | ||||||||
WBStrain00034509 | ||||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1011 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003670 | ||||||
Transcript | H10E21.3b.1 (11) | |||||||
H10E21.3a.1 (11) | ||||||||
Interactor | WBInteraction000502412 | |||||||
WBInteraction000502413 | ||||||||
WBInteraction000502414 | ||||||||
WBInteraction000524837 | ||||||||
WBInteraction000535447 | ||||||||
WBInteraction000542319 | ||||||||
WBInteraction000542320 | ||||||||
WBInteraction000542321 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00046225 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | However, OEA analog supplementation (with KDS-5104) decreased life span in the nhr-80(tm1011) mutant (fig. S15 and table S1). | Paper_evidence | WBPaper00046225 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Reference | WBPaper00046225 | |||||||
WBPaper00062224 | ||||||||
Remark | 9565/9566-10011/10012 (446 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |