WormBase Tree Display for Variation: WBVar00250054
expand all nodes | collapse all nodes | view schema
WBVar00250054 | Name | Public_name | tm1034 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | Y49E10.11a.2:c.918_935-11delinsT | ||||||||
Y49E10.11a.1:c.918_935-11delinsT | |||||||||
Y49E10.11c.1:c.918_935-11delinsT | |||||||||
Y49E10.11b.1:c.918_935-11delinsT | |||||||||
HGVSg | CHROMOSOME_III:g.12414983_12415579delinsA | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y49E10 | |||||
Flanking_sequences | tgagccttttggatcgtgttctgcaaattt | caagcctgtggaatattatttcccctccaa | |||||||
Mapping_target | Y49E10 | ||||||||
Source_location | 7 | CHROMOSOME_III | 12414982 | 12415580 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | A | |||||||
Deletion | |||||||||
PCR_product | tm1034_external | ||||||||
tm1034_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1034 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00013034 | |||||||
Transcript | Y49E10.11c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y49E10.11c.1:c.918_935-11delinsT | ||||||||
cDNA_position | 1073-? | ||||||||
CDS_position | 918-? | ||||||||
Protein_position | 306-? | ||||||||
Intron_number | 8/20 | ||||||||
Exon_number | 8/21 | ||||||||
Y49E10.11b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y49E10.11b.1:c.918_935-11delinsT | ||||||||
cDNA_position | 918-? | ||||||||
CDS_position | 918-? | ||||||||
Protein_position | 306-? | ||||||||
Intron_number | 6/15 | ||||||||
Exon_number | 6/16 | ||||||||
Y49E10.11a.2 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y49E10.11a.2:c.918_935-11delinsT | ||||||||
cDNA_position | 985-? | ||||||||
CDS_position | 918-? | ||||||||
Protein_position | 306-? | ||||||||
Intron_number | 7/18 | ||||||||
Exon_number | 7/19 | ||||||||
Y49E10.11a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y49E10.11a.1:c.918_935-11delinsT | ||||||||
cDNA_position | 1221-? | ||||||||
CDS_position | 918-? | ||||||||
Protein_position | 306-? | ||||||||
Intron_number | 8/19 | ||||||||
Exon_number | 8/20 | ||||||||
Interactor | WBInteraction000050586 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | III | |||||||
Description | Phenotype | WBPhenotype:0001428 | Paper_evidence | WBPaper00032283 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals raised at 25 C displayed the same vacuolation phenotype as tat-1(kr15). | Paper_evidence | WBPaper00032283 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00032283 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00032283 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15, 20, 25 | Paper_evidence | WBPaper00032283 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from M. Han to the National Bioresource Project of Japan: normal growth rate. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00032283 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. S. Tuck: Traffick 10, 88 (2009). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
Worms are viable. | Paper_evidence | WBPaper00032283 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00032283 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00032283 | ||||||||
Remark | 47578/47579-A-48175/48176 (597 bp deletion + 1 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |