WormBase Tree Display for Variation: WBVar00250068
expand all nodes | collapse all nodes | view schema
| WBVar00250068 | Name | Public_name | tm1049 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name (11) | |||||||||
| HGVSg | CHROMOSOME_IV:g.11441536_11443007delinsTTTTTTCTGTAAAAAAATTCAAAAAAATTCA | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C10C6 | |||||
| Flanking_sequences | actcgagactattctgtaaaaaaattcata | gactggtgggctctcggaattatcctgtac | |||||||
| Mapping_target | C10C6 | ||||||||
| Source_location | 7 | CHROMOSOME_IV | 11441535 | 11443008 | Inferred_automatically | National_Bioresource_Project | |||
| Type_of_mutation | Insertion | TTTTTTCTGTAAAAAAATTCAAAAAAATTCA | |||||||
| Deletion | |||||||||
| PCR_product | tm1049_external | ||||||||
| tm1049_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | FX | ||||||||
| Author | Mitani S | ||||||||
| DB_info | Database | National_Bioresource_Project | seq | 1049 | |||||
| NBP_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00002192 | |||||||
| Transcript (11) | |||||||||
| Isolation | Mutagen | TMP/UV | |||||||
| Genetics | Map | IV | |||||||
| Description | Phenotype | WBPhenotype:0000007 | Person_evidence | WBPerson24280 | |||||
| Curator_confirmed | WBPerson24280 | ||||||||
| WBPhenotype:0000697 | Person_evidence | WBPerson24280 | |||||||
| Curator_confirmed | WBPerson24280 | ||||||||
| WBPhenotype:0001739 | Paper_evidence | WBPaper00056219 | |||||||
| Curator_confirmed | WBPerson24280 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000102 | Person_evidence | WBPerson7743 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Comment from Dr. K. Shen to the National Bioresource Project of Japan: normal HSN vulval presynaptic vesicle clusters (unc-86::SNB-1::YFP). | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000640 | Person_evidence | WBPerson7743 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Comment from Dr. K. Shen to the National Bioresource Project of Japan: no obvious egg laying defects. | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00056219 | ||||||||
| Remark | 5784/5785-TTTTTTCTGTAAAAAAATTCAAAAAAATTCA-7256/7257 (1472 bp deletion + 31 bp insertion) | ||||||||
| This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
| Method | NBP_knockout_allele |
