WormBase Tree Display for Variation: WBVar00250072
expand all nodes | collapse all nodes | view schema
WBVar00250072 | Name | Public_name | tm1053 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_II:g.5556497_5556837del | |||||||
Sequence_details | SMap | S_parent | Sequence | C17C3 | ||||
Flanking_sequences | tttgttcacaaaacattggatttttcattg | agcgcctcaccatgacaaacggcacactgc | ||||||
Mapping_target | C17C3 | |||||||
Source_location | 7 | CHROMOSOME_II | 5556496 | 5556838 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1053_external | |||||||
tm1053_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00007572 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1053 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002094 | ||||||
Transcript | C17C3.4.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-107 | |||||||
CDS_position | ?-77 | |||||||
Protein_position | ?-26 | |||||||
Exon_number | 1-2/4 | |||||||
Interactor | WBInteraction000543198 | |||||||
WBInteraction000543223 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0002284 | Paper_evidence | WBPaper00043908 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002289 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002295 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002328 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000823 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. T. Katada: No abnormal proliferation in Z2/Z3 cells during L1 diapause. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001182 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. K. Ashrafi: normal Nile Red staining. Dr. J. Kaplan: normal nile red staining. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KQ | |||||||
KP | ||||||||
WBPhenotype:0001507 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. C-S. Chen: normal sensitivity to Bacillus pore-forming toxin. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00043908 | |||||||
Remark | 26387/26388-26728/26729 (341 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |