WormBase Tree Display for Variation: WBVar00250072

WBVar00250072 Name: Public_name: tm1053
    HGVSg: CHROMOSOME_II:g.5556497_5556837del
  Sequence_details: SMap: S_parent: Sequence: C17C3
    Flanking_sequences: tttgttcacaaaacattggatttttcattg agcgcctcaccatgacaaacggcacactgc
    Mapping_target: C17C3
    Source_location: 7 CHROMOSOME_II 5556496 5556838 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1053_external
      tm1053_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00007572
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1053
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002094
    Transcript: C17C3.4.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-107
        CDS_position: ?-77
        Protein_position: ?-26
        Exon_number: 1-2/4
    Interactor: WBInteraction000543198
      WBInteraction000543223
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0002284 Paper_evidence: WBPaper00043908
        Curator_confirmed: WBPerson2987
      WBPhenotype:0002289 Paper_evidence: WBPaper00043908
        Curator_confirmed: WBPerson2987
      WBPhenotype:0002295 Paper_evidence: WBPaper00043908
        Curator_confirmed: WBPerson2987
      WBPhenotype:0002328 Paper_evidence: WBPaper00043908
        Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000823 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. T. Katada: No abnormal proliferation in Z2/Z3 cells during L1 diapause. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001182 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. K. Ashrafi: normal Nile Red staining. Dr. J. Kaplan: normal nile red staining. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KQ
              KP
      WBPhenotype:0001507 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. C-S. Chen: normal sensitivity to Bacillus pore-forming toxin. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00043908
  Remark: 26387/26388-26728/26729 (341 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele