WormBase Tree Display for Variation: WBVar00250111
expand all nodes | collapse all nodes | view schema
WBVar00250111 | Name | Public_name | tm1094 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C01G5.2:n.396_1403+10delinsACTTGTTTAATTGTTAAACACTTGTTT | ||||||||
HGVSg | CHROMOSOME_IV:g.6528299_6529363delinsAAACAAGTGTTTAACAATTAAACAAGT | ||||||||
Sequence_details | SMap | S_parent | Sequence | C01G5 | |||||
Flanking_sequences | aaaaaaaatttgtttaacaattaaacaagt | gagttatcattagggtgttgaacctcgatc | |||||||
Mapping_target | C01G5 | ||||||||
Source_location | 7 | CHROMOSOME_IV | 6528298 | 6529364 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | AAACAAGTGTTTAACAATTAAACAAGT | |||||||
Deletion | |||||||||
PCR_product | tm1094_external | ||||||||
tm1094_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00040454 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1094 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004179 | |||||||
WBGene00305249 | |||||||||
Transcript | C01G5.26 | ||||||||
Pseudogene | C01G5.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,non_coding_transcript_exon_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G5.2:n.396_1403+10delinsACTTGTTTAATTGTTAAACACTTGTTT | ||||||||
cDNA_position | 396-? | ||||||||
Intron_number | 2-3/7 | ||||||||
Exon_number | 2-3/8 | ||||||||
Interactor | WBInteraction000052130 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | IV | |||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comments to the NBP from Dr. C. Mello, Cell 127, 747-457 (2006); Dr. E. Miska; Mol Cell 31, 79-90 (2008). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WM | |||||||||
SX | |||||||||
WBPhenotype:0000113 | Paper_evidence | WBPaper00031903 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Expression of 21 U RNAs was normal. | Paper_evidence | WBPaper00031903 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00031903 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Samples were enriched for RNAs <200 bp and used in northern analysis to examine the expression profile of the 21U-RNA 21ur-1 as | Paper_evidence | WBPaper00031903 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00031903 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Brood size is not significantly different from that of wild-type at 20 or 25C (scored for more than 8 animals on average / trial, n=3 trials). | Paper_evidence | WBPaper00031903 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031903 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00031903 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00031903 | |||||||
WBPaper00031961 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited wild-type brood sizes at both 20C and 25C. | Paper_evidence | WBPaper00031961 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031903 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00031903 | |||||
WBPaper00031961 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000812 | Paper_evidence | WBPaper00031903 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Number and development of germ cells were not significantly different from wild-type as assayed by DIC microscopy and DAPI staining analysis. | Paper_evidence | WBPaper00031903 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031903 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00031903 | |||||||
WBPaper00031961 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mitotic germ cell number (monitored with phosphoS10 histone H3 staining) was not significantly different from wild-type. | Paper_evidence | WBPaper00031903 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals had normal numbers and morphologically wild-type germ cells. | Paper_evidence | WBPaper00031961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031903 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00031903 | |||||
Curator_confirmed | WBPerson712 | ||||||||
20, 25 | Paper_evidence | WBPaper00031961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001759 | Paper_evidence | WBPaper00031962 | |||||||
WBPaper00031961 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PRG-2 is not required for piRNA (21U-RNA) expression, as determined by comparable levels of 21U-RNA on Northern and or through qRT-PCR to that of wild-type. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
21U-RNA expression was not altered compared with expression in wild-type animals. | Paper_evidence | WBPaper00031961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | GO_term | GO:0034585 | PATO:0000460 | Paper_evidence | WBPaper00031962 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001772 | Paper_evidence | WBPaper00031962 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not exhibit any increase in levels of either Tc1 or Tc3 transposase mRNA compared to control. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001779 | Paper_evidence | WBPaper00031961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | miRNA expression was not altered. | Paper_evidence | WBPaper00031961 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00031961 | ||||||||
WBPaper00031962 | |||||||||
WBPaper00031903 | |||||||||
Remark | 14468/14469-AAACAAGTGTTTAACAATTAAACAAGT-15533/15534 (1065 bp deletion + 27 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |