WormBase Tree Display for Variation: WBVar00250125
expand all nodes | collapse all nodes | view schema
| WBVar00250125 | Name | Public_name | tm1108 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | T12E12.4a.2:c.576_954delinsCTCCAGCGAACCAGGATT | ||||||||
| T12E12.4b.2:c.576_954delinsCTCCAGCGAACCAGGATT | |||||||||
| CE30173:p.Phe193SerfsTer27 | |||||||||
| CE30172:p.Phe193SerfsTer27 | |||||||||
| T12E12.4a.1:c.576_954delinsCTCCAGCGAACCAGGATT | |||||||||
| T12E12.4b.1:c.576_954delinsCTCCAGCGAACCAGGATT | |||||||||
| HGVSg | CHROMOSOME_IV:g.5539115_5539538delinsCTCCAGCGAACCAGGATT | ||||||||
| Sequence_details | SMap | S_parent | Sequence | T12E12 | |||||
| Flanking_sequences | cattctggctgtaactccagcgaaccagga | tcggatcttgttgcattcggtgaaccagtt | |||||||
| Mapping_target | T12E12 | ||||||||
| Source_location | 7 | CHROMOSOME_IV | 5539114 | 5539539 | Inferred_automatically | National_Bioresource_Project | |||
| Type_of_mutation | Insertion | CTCCAGCGAACCAGGATT | |||||||
| Deletion | |||||||||
| PCR_product | tm1108_external | ||||||||
| tm1108_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00005196 | ||||||||
| Laboratory | FX | ||||||||
| Author | Mitani S | ||||||||
| DB_info | Database | National_Bioresource_Project | seq | 1108 | |||||
| NBP_allele | |||||||||
| Status | Live | ||||||||
| Affects (3) | |||||||||
| Isolation | Mutagen | TMP/UV | |||||||
| Genetics | Map | IV | |||||||
| Description | Phenotype (16) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Comment from Dr. D. Xue to the National Bioresource Project of Japan: slow growth but not lethal or sterile. Originally classified as lethal OR sterile by the National Bioresource Project of Japan. Mol Cell, 31, 586 (2008). | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000140 | Paper_evidence | WBPaper00041209 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | did not significantly exacerbate L3 arrest at any time point | Paper_evidence | WBPaper00041209 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Affected_by | Molecule | WBMol:00003513 | Paper_evidence | WBPaper00041209 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00041209 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | serial ultraviolet C radiation(UVC) exposure (10 J/m2) | Paper_evidence | WBPaper00041209 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000643 | Person_evidence | WBPerson7743 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Comment from Dr. A. van der Bliek to the National Bioresource Project of Japan: Normal locomotion. | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001983 | Paper_evidence | WBPaper00056369 | |||||||
| Curator_confirmed | WBPerson9270 | ||||||||
| Disease_info | Models_disease | DOID:14330 | |||||||
| Models_disease_in_annotation | WBDOannot00000741 | ||||||||
| Reference | WBPaper00038057 | ||||||||
| WBPaper00041209 | |||||||||
| WBPaper00033026 | |||||||||
| WBPaper00035144 | |||||||||
| WBPaper00044205 | |||||||||
| WBPaper00047030 | |||||||||
| WBPaper00056369 | |||||||||
| WBPaper00064979 | |||||||||
| WBPaper00065803 | |||||||||
| Remark (2) | |||||||||
| Method | NBP_knockout_allele |
