WormBase Tree Display for Variation: WBVar00250139

WBVar00250139 Name: Public_name: tm1122
    Other_name: F55A12.1:n.2085_2946del
    HGVSg: CHROMOSOME_I:g.5370653_5371653del
  Sequence_details: SMap: S_parent: Sequence: F55A12
    Flanking_sequences: ttacttcccggctgaactgatgaccatttc gtcttggctccttcaacacaggatgtaatt
    Mapping_target: F55A12
    Source_location: 7 CHROMOSOME_I 5370652 5371654 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1122_external
      tm1122_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1122
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018862
    Pseudogene: F55A12.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,non_coding_transcript_exon_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F55A12.1:n.2085_2946del
        cDNA_position: 2085-2946
        Intron_number: 3-5/8
        Exon_number: 3-6/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. C. Mello, Cell 127, 747-457 (2006). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 31785/31786-32786/32787 (1001 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele