WormBase Tree Display for Variation: WBVar00250164
expand all nodes | collapse all nodes | view schema
WBVar00250164 | Name | Public_name | tm1148 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C08B11.8.2:c.-123_-2-16del | |||||||
HGVSg | CHROMOSOME_II:g.8039805_8039992del | |||||||
Sequence_details | SMap | S_parent | Sequence | C08B11 | ||||
Flanking_sequences | atttttatgatggcctagaaacttgaattg | aatgaaatttttcagacatgaaagaaagaa | ||||||
Mapping_target | C08B11 | |||||||
Source_location | 7 | CHROMOSOME_II | 8039804 | 8039993 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1148_external | |||||||
tm1148_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1148 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00007435 | ||||||
Transcript | C08B11.8.2 | VEP_consequence | splice_donor_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C08B11.8.2:c.-123_-2-16del | |||||||
cDNA_position | 4-? | |||||||
Intron_number | 1/7 | |||||||
Exon_number | 1/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000032 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Inoue to the National Bioresource Project of Japan: healthy. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. Expression of the C08B11.7 gene was detected by RT-PCR. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Inoue to the National Bioresource Project of Japan: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Inoue to the National Bioresource Project of Japan: fertile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 23682/23683-23870/23871 (188 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |