WormBase Tree Display for Variation: WBVar00250188

WBVar00250188 Name: Public_name: tm1176
    Other_name: T28D6.7.1:c.217+323_304+84del
    HGVSg: CHROMOSOME_III:g.11345398_11345932del
  Sequence_details: SMap: S_parent: Sequence: T28D6
    Flanking_sequences: ctcccgcattttttgtagatcaagccaaaa atcccctacagtatcactacagtacctctc
    Mapping_target: T28D6
    Source_location: 7 CHROMOSOME_III 11345397 11345933 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1176_external
      tm1176_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1176
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012127
    Transcript: T28D6.7.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T28D6.7.1:c.217+323_304+84del
        Intron_number: 2-3/5
        Exon_number: 3/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype_not_observed: WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT embryonic lethality. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000054 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT larval lethality. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000673 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT brood size. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000676 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT growth rate. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0002535 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. O. Blacque to the National Bioresource Project of Japan: dye-filling normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OEB
  Remark: 9533/9534-10068/10069 (535 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele