WormBase Tree Display for Variation: WBVar00250201
expand all nodes | collapse all nodes | view schema
WBVar00250201 | Name | Public_name | tm1189 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C06H2.2.1:c.267_700delinsAA | |||||||
CE43824:p.Trp89_Ter234delinsTer | ||||||||
HGVSg | CHROMOSOME_V:g.11125981_11126463delinsAA | |||||||
Sequence_details | SMap | S_parent | Sequence | C06H2 | ||||
Flanking_sequences | tgctcatcgaaagacacctggaaaaggatg | acattttaacatattgtgacaatccagagg | ||||||
Mapping_target | C06H2 | |||||||
Source_location | 7 | CHROMOSOME_V | 11125980 | 11126464 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AA | ||||||
Deletion | ||||||||
PCR_product | tm1189_external | |||||||
tm1189_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1189 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00007386 | ||||||
Transcript | C06H2.2.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000050 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT embryonic lethality. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000054 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT larval lehtality. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000673 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT brood size. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000676 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT growth rate. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 4463/4464-AA-4946/4947 (483 bp deletion + 2 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |