WormBase Tree Display for Variation: WBVar00250220
expand all nodes | collapse all nodes | view schema
WBVar00250220 | Name | Public_name | tm1210 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y56A3A.12a.2:c.-32-968_-32-422delinsC | |||||||
Y56A3A.12b.2:c.-32-968_-32-422delinsC | ||||||||
HGVSg | CHROMOSOME_III:g.11907331_11907877delinsG | |||||||
Sequence_details | SMap | S_parent | Sequence | Y56A3A | ||||
Flanking_sequences | aatgcaaatccgctgagcaccttctgaccc | ggattcactgtgaaacattggattgaacatgttgcttatgtactctgtagga | ||||||
Mapping_target | Y56A3A | |||||||
Source_location | 7 | CHROMOSOME_III | 11907330 | 11907878 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | G | ||||||
Deletion | ||||||||
PCR_product | tm1210_external | |||||||
tm1210_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1210 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00013233 | ||||||
WBGene00013232 | ||||||||
Transcript | Y56A3A.12a.3 | VEP_consequence | 5_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-57 | |||||||
Exon_number | 1/10 | |||||||
Y56A3A.12b.2 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | Y56A3A.12b.2:c.-32-968_-32-422delinsC | |||||||
Intron_number | 1/8 | |||||||
Y56A3A.14.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-358 | |||||||
CDS_position | ?-306 | |||||||
Protein_position | ?-102 | |||||||
Intron_number | 2/3 | |||||||
Exon_number | 1-3/4 | |||||||
Y56A3A.12a.2 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | Y56A3A.12a.2:c.-32-968_-32-422delinsC | |||||||
Intron_number | 1/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Mapping_data | In_multi_point | 5445 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000640 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: normal egg-laying. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000661 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: solitary social feeding. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: fertile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 73531/73532-G-74078/74079 (547 bp deletion + 1 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |