WormBase Tree Display for Variation: WBVar00250301

WBVar00250301 Name: Public_name: tm1297
    Other_name: F29C4.6.1:c.165+131_668delinsC
      F29C4.6.2:c.165+131_668delinsC
    HGVSg: CHROMOSOME_IV:g.120577_121402delinsG
  Sequence_details: SMap: S_parent: Sequence: F29C4
    Flanking_sequences: tccaattgatttgttctcgcatacatcaca gtttttttttttgaaaatttgatttaaaaa
    Mapping_target: F29C4
    Source_location: 7 CHROMOSOME_IV 120576 121403 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: G
      Deletion
    PCR_product: tm1297_external
      tm1297_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1297
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00017928
    Transcript: F29C4.6.2 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F29C4.6.2:c.165+131_668delinsC
        cDNA_position: ?-668
        CDS_position: ?-668
        Protein_position: ?-223
        Intron_number: 1/3
        Exon_number: 2/4
      F29C4.6.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F29C4.6.1:c.165+131_668delinsC
        cDNA_position: ?-678
        CDS_position: ?-668
        Protein_position: ?-223
        Intron_number: 2/4
        Exon_number: 3/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000028 Paper_evidence: WBPaper00033042
        Curator_confirmed: WBPerson2021
        Remark: Thiolation of tRNAs is disrupted in mutants Paper_evidence: WBPaper00033042
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: APM gel analysis Paper_evidence: WBPaper00033042
              Curator_confirmed: WBPerson2021
      WBPhenotype:0000154 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. R. Plasterk to the National Bioresource Project of Japan: reduced brood size. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment to the National Bioresource Project of Japan from Dr. R. Plasterk: sterile at 25C; Dr. M. Peter: Nature 458, 228 (2009). Dr. A. Bystrom: PLoS Genetics 5, e1000561 (2009). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0002468 Paper_evidence: WBPaper00046894
        Curator_confirmed: WBPerson2725
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Peter: Nature 458, 228 (2009); Dr. A. Bystrom: PLoS Genetics 5, e1000561 (2009). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00033042
    WBPaper00046894
  Remark: 10824/10825-G-11650/11651 (826 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele