WormBase Tree Display for Variation: WBVar00250302

WBVar00250302 Name: Public_name: tm1298
    Other_name: Y41E3.9b.1:c.1001-212_1025del
      Y41E3.9a.1:c.2765-212_2789del
    HGVSg: CHROMOSOME_IV:g.15032211_15032447del
  Sequence_details: SMap: S_parent: Sequence: Y41E3
    Flanking_sequences: cgagggaactcgatcagaattcagccaaaa aaaatcccactacattccactgaaactccg
    Mapping_target: Y41E3
    Source_location: 7 CHROMOSOME_IV 15032210 15032448 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1298_external
      tm1298_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00028632
    Component_of_genotype: WBGenotype00000006
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1298
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012767
    Transcript: Y41E3.9a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y41E3.9a.1:c.2765-212_2789del
        cDNA_position: ?-2800
        CDS_position: ?-2789
        Protein_position: ?-930
        Intron_number: 7/11
        Exon_number: 8/12
      Y41E3.9b.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y41E3.9b.1:c.1001-212_1025del
        cDNA_position: ?-1025
        CDS_position: ?-1025
        Protein_position: ?-342
        Intron_number: 2/5
        Exon_number: 3/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype (16)
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Comment to the NBP from Dr. S. Boulton: DNA repair in press. Dr. H-S. Koo: BBRC 352, 479 (2007). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000875 Paper_evidence: WBPaper00035602
        Curator_confirmed: WBPerson2021
        Remark: The DNA replication checkpoint activation is not compromised in fcd-2 mutant strains Paper_evidence: WBPaper00035602
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001349 Paper_evidence: WBPaper00035602
        Curator_confirmed: WBPerson2021
        Remark: Induced CHK-1 phosphorylation is not affected in fcd-2 mutants Paper_evidence: WBPaper00035602
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001391 Paper_evidence: WBPaper00028819
        Curator_confirmed: WBPerson48
        Remark: Irradiation does not increase the number of apoptotic germ cells in mutant gonads compared with wild-type gonads. Paper_evidence: WBPaper00028819
            Curator_confirmed: WBPerson48
      WBPhenotype:0001760 Paper_evidence: WBPaper00031945
        Curator_confirmed: WBPerson712
        Remark: No increase in deletion frequency over wild-type was observed for the endogenous qua375 sequence as determined by PCR. At least 24 populations of 5 animals were assayed. Paper_evidence: WBPaper00031945
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: pkIs2165[pRP1878: hsp-16.41::ATG-(C)23-stops-LacZ unc-119] or pkIs2172 [pRP1889: hsp-16.41::ATG-(monoA)-stops-LacZ unc-119] Paper_evidence: WBPaper00031945
              Curator_confirmed: WBPerson712
  Disease_info: Models_disease: DOID:13636
    Models_disease_in_annotation: WBDOannot00000846
  Reference: WBPaper00031945
    WBPaper00035602
    WBPaper00031868
    WBPaper00028819
  Remark: 81469/81470-81706/81707 (237 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele