WormBase Tree Display for Variation: WBVar00250314

WBVar00250314 Name: Public_name: tm1312
    Other_name (11)
    HGVSg: CHROMOSOME_IV:g.12368831_12369325del
  Sequence_details: SMap: S_parent: Sequence: ZC518
    Flanking_sequences: tgctacaatgtgctgtgtgacaagtacgct gaatgacaacgtggtcggaaatcctcttgt
    Mapping_target: ZC518
    Source_location: 7 CHROMOSOME_IV 12368830 12369326 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1312_external
      tm1312_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1312
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000376
    Transcript: ZC518.3e.1 (11)
      ZC518.3c.2 (11)
      ZC518.3a.1 (11)
      ZC518.3d.1 (11)
      ZC518.3c.1 (11)
      ZC518.3b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Paper_evidence: WBPaper00031487
        Curator_confirmed: WBPerson43879
        Penetrance: Incomplete: Paper_evidence: WBPaper00031487
              Curator_confirmed: WBPerson43879
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. A. Puoti: occasional sterilities (3%). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: AP
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Sawa to the National Bioresource Project of Japan: not Psa. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: HS
  Reference: WBPaper00031487
  Remark: 21011/21012-21506/21507 (495 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele