WormBase Tree Display for Variation: WBVar00250324

WBVar00250324 Name: Public_name: tm1326
    HGVSg: CHROMOSOME_IV:g.9074444_9075059del
  Sequence_details: SMap: S_parent: Sequence: ZC410
    Flanking_sequences: cggccgcgtttgtgaaagttcttccattcg atccgaatttttcagggaacgcctcgccgg
    Mapping_target: ZC410
    Source_location: 7 CHROMOSOME_IV 9074443 9075060 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1326_external
      tm1326_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1326
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00013880
    Transcript: ZC410.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2-4/10
        Exon_number: 1-4/11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 8292/8293-8908/8909 (616 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele